circad | circRNAs associated with diseases

mmu_circRNA_30884
Gene	n/a	Organism	Mouse
Genome Locus	n/a	Build	n/a
Disease	Osteogenesis	ICD-10	Osteogenesis imperfecta (Q78.0)
DBLink	Link to database	PMID	29700558
Experimental Method
Sample Type	Mouse Adipose-Derived Stromal Cells	Comparison	Osteogenic Differentiation of mADSCs at Different Stages
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CATCCCTTCCTGGCTAAATAC Reverse GGCCACCAATATATAATTCTCAC	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Long, T, Guo, Z, Han, L, Yuan, X, Liu, L, Jing, W, Tian, W, Zheng, XH, Tang, W, Long, J (2018). Differential Expression Profiles of Circular RNAs During Osteogenic Differentiation of Mouse Adipose-Derived Stromal Cells. Calcif. Tissue Int., 103, 3:338-352.